Marc Santos is a Guides Staff Writer from the Philippines with a BA in Communication Arts and over six years of experience in writing gaming news and guides. He plays just about everything, from ...

Discover cards are currently not available on CNBC Select and links have been redirected to our credit card marketplace where you can review offers from other issuers like American Express or Chase.

Share Share Article via Facebook Share Article via Twitter Share Article via LinkedIn Share Article via Email A good credit score is key to many financial tools. If you don't have enough credit ...

C.E.O.s and Harvard professors ae making A.I.-powered doubles that answer questions and attend meetings. By Sarah Kessler It started as a writing assistant. Jeremy Allaire, the C.E.O. of the ...

Some home remedies like warm baths, saline drops, and clean air may help an infant who is congested. However, it’s important to speak with a doctor if the infant also has other symptoms like fever.

A reverse primer designed from EST aa306952 (5′–CGTAACACTCCATGGAAATCAGC–3′) and a forward primer designed from the ORF upstream to EST aa306952 (5′–ATGAAGGATGTTATGTCAGCTCTGT–3′) were used to amplified ...

The Runes of Aldur league in Path of Exile 2 is all about Runesmithing, as far as themes go. The league's main mechanic isn't that different from most of the other ones that came before it — touch a ...