A reverse primer designed from EST aa306952 (5′–CGTAACACTCCATGGAAATCAGC–3′) and a forward primer designed from the ORF upstream to EST aa306952 (5′–ATGAAGGATGTTATGTCAGCTCTGT–3′) were used to amplified ...
Even if you're perfectly content with Windows 10, you'll soon need to switch to Windows 11 for security reasons. We compare the two operating systems so you know what to expect upon upgrading. I've ...
MINNESOTA, USA — Due to heat, humidity, and ongoing storm chances, KARE 11 Weather Team has issued a Weather Impact Alert today. High temperatures are expected to climb into the middle and upper 90s ...
Even though flu season is ramping up, the real silent killer here at University of Wisconsin is academic fatigue. It may not give you a stuffy nose or a fever, but it’ll ruin your life just the same.
Some results have been hidden because they may be inaccessible to you
Show inaccessible results